Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0005836 | |||
Gene | TRAPPC6B | Organism | Human |
Genome Locus | chr14:39623414-39627606:- | Build | hg19 |
Disease | Active Pulmonary Tuberculosis | ICD-10 | Respiratory tuberculosis, bacteriologically and histologically confirmed (A15-A19) |
DBLink | Link to database | PMID | 28846924 |
Experimental Method | |||
Sample Type | Peripheral Blood Mononuclear Cells (PBMCs) | Comparison | Peripheral Blood Mononuclear Cells (PBMCs) from Active Pulmonary Tuberculosis (APTB) (n=10) and Controls (n=10) |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ACTCATCCTTGAACCTTGC ReverseGGCATCTATGTACTTCAGGAC | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Zhuang, ZG, Zhang, JA, Luo, HL, Liu, GB, Lu, YB, Ge, NH, Zheng, BY, Li, RX, Chen, C, Wang, X, Liu, YQ, Liu, FH, Zhou, Y, Cai, XZ, Chen, ZW, Xu, JF (2017). The circular RNA of peripheral blood mononuclear cells: Hsa_circ_0005836 as a new diagnostic biomarker and therapeutic target of active pulmonary tuberculosis. Mol. Immunol., 90:264-272. |